My Forking Life

  • Air Fryer
  • Jamaican
  • Entree
  • Browse Recipes
  • Breakfast
  • Side Dishes
  • About
menu icon
  • Home
  • General
  • Guides
  • Reviews
  • News
  • Air Fryer
  • Jamaican
  • Entree
  • Browse Recipes
  • Breakfast
  • Side Dishes
  • About
search icon
Homepage link
  • Air Fryer
  • Jamaican
  • Entree
  • Browse Recipes
  • Breakfast
  • Side Dishes
  • About
×

Primer3 Input [top] -

SEQUENCE_ID=TP53_exon7_test SEQUENCE_TEMPLATE=GGACCTGGTCCTCTGACTGCTCTTTTCACCCATCTACAGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGGTCAGTTGCCCTGAGGGGCTGGCTTCCATGAGACTTCAT PRIMER_TASK=pick_pcr_primers SEQUENCE_TARGET=120,1

SEQUENCE_INTERNAL_OLIGO_MIN_SIZE=18 SEQUENCE_INTERNAL_OLIGO_OPT_TM=55.0 Save this as my_primers.txt : primer3 input

PRIMER_MAX_POLY_X=4 # Max mononucleotide repeats (e.g., AAAA) PRIMER_GC_CLAMP=1 # Require G or C in last 5 bases of 3' end PRIMER_MAX_SELF_ANY=4.0 PRIMER_MAX_SELF_END=3.0 PRIMER_NUM_RETURN=5 | | No valid primers found | Your

It signals "end of input" to Primer3. Running It (Command Line) primer3_core < my_primers.txt > my_primers_output.txt Debugging Common Input Errors | Error Message | Likely Fix | | :--- | :--- | | Sequence is shorter than product range | Your SEQUENCE_TEMPLATE is too short. Add flanking bases. | | No valid primers found | Your Tm range is too narrow, or SEQUENCE_TARGET is too close to the end of the template. | | No left primer found | Check PRIMER_MAX_POLY_X or PRIMER_MIN_GC . You are being too strict. | Final Takeaway Primer3 is not a mystery. It is a declarative engine . You define the landscape (sequence) and the constraints (Tm, size, target), and it calculates the best path through the DNA. | Final Takeaway Primer3 is not a mystery

Today, we are tearing down the primer3_core input file. Primer3 input is plain text. It uses a simple KEY=VALUE syntax. The engine reads these parameters, processes the sequence, and spits out the best primers.

primer3 input

Welcome!

Welcome to My Forking Life! Hi, I'm Tanya, attorney, busy wife and mom, and lover of quick, easy, and delicious meals.

More about me

Popular Recipes

  • # Bbwdraw .com
  • #02tvmoviesseries.com/
  • #1 Song In 1997
  • #2 Emu Os Com
  • #90 Middle Class Biopic

Holiday Favorites

  • sweet potato pie on a plate
    Southern Sweet Potato Pie Recipe
  • spoon lifting gravy out of gravy dish
    Easy Recipe for Gravy without Drippings
  • Stirring the giblet gravy with a spoon.
    Grandma's Giblet Gravy Recipe
  • creamy baked macaroni and cheese, the best baked macaroni and cheese, creamy mac and cheese
    Creamy Baked Macaroni and Cheese
as seen on...various online websites text listed

Footer

↑ back to top
  • Privacy Policy
  • Contact
  • About Tanya

As an Amazon Associate, I earn from qualifying purchases.

Copyright © 2026 Nova Lighthouse. All rights reserved.

Rate This Recipe

Your vote:




A rating is required
A name is required
An email is required

Recipe Ratings without Comment

Something went wrong. Please try again.